|
Post by reasonable on Oct 9, 2007 20:18:21 GMT -5
The admins appear on a power trip. Admins, how does it feel to decide who/when becomes privy to vital information? And why did you remove that thread completely?
|
|
|
Post by Administration on Oct 9, 2007 21:03:20 GMT -5
The admins appear on a power trip. Admins, how does it feel to decide who/when becomes privy to vital information? And why did you remove that thread completely? Power trip and vital information??? Give me a break! If we don't want people judging and criticizing when they don't even have all the facts yet, that's OUR business. I told you days ago we might not allow those derogatory comments to continue and I won't apologize for stopping them now. You can make all the angry posts and assumptions you want but this forum will not continue to be the source of negative and incorrect information about the only people who have bent over backwards to help us. If you don't appreciate what they are trying to do, shame on you. If you don't appreciate what we are trying to do here, we can't make you stay. Maybe you'd be better off at a place where dissing, lies, and everything else under the sun that hurts people is allowed. Just for the record (as Lilsissy stated), you ARE acting like children in a kindergarten class and we don't have the time to monitor tantrums each time you don't get your way.
|
|
|
Post by janedough on Oct 9, 2007 21:22:40 GMT -5
Sorry to disagree with you Admin, but fortunately for us, they are NOT the only ones who have bent over backward for US. Please, with ALL DUE RESPECT, let us be the judge of who bends the furthest for us.
|
|
|
Post by microdot on Oct 9, 2007 21:26:20 GMT -5
I'm with you Ann, my tounge is swelled up too, But I do recall one researcher who has NEVER held back or lied about what this is. Mr. VanEeden claims to have this agent in culture. He has personally related to me that the molecular identification of the fungus has recently been completed by world renowned CBS in Utrecht, the Netherlands. www.cbs.knaw.nl/blogs.wsj.com/informedreader/2007/09/13/disease-or-delusion-new-findings-in-morgellons-debate/“A coincidence is that on September 11th the final identification has taken place of the main etiological agent that causes this type infection. Initially two fungi have been isolated by a laboratory in the Netherlands: The results of the screening are as follows: A = Phoma sp. Affinities with ascomycetes like Phaeospheria spp. from the order of the Pleosporales are suggested on the basis of the ITS sequence. No teleomorph was observed in the subcultures, only a Phoma-state that could not be identified to species level. For further reading please visit: www.doctorfungus.org/Thefungi/phoma.htmB = Agrocybe pediades (Fr.) Fayod The identification was based on the ITS sequence. It is unclear of this fungus is a contaminant. In an earlier instance also Fusarium spp. has been isolated from a similar strain. Also this type isolate will keep the status of contaminant until future tests will indicate the contrary. Based on the available molecular screening results, infection with this type agent could best be treated as: phaeohyphomycosis. The first two sequences (ITS of A and B) will soon be published via the reference site of: www.silentsuperbug.comYours sincerely, BellVanEeden Comment by P.D.F. VanEeden - September 14, 2007 at 4:57 pm For the purpose of archiving consistent and reliable information the ITS sequences of the earlier mentioned screening are made part of the public domain via: THE WALL STREET JOURNAL. A = Phoma sp. Affinities with ascomycetes like Phaeosphaeria spp. from the order of the Pleosporales are suggested on the basis of the ITS sequence. No teleomorph was observed in our subcultures, only a Phoma-state that could not be identified to species level. >Contig_1 ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGA AAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGG CGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAAC TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCA GTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTA CCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTG TATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT AATAATTACTTGCAACCATCAAGTCTA B = Agrocybe pediades (Fr.) Fayod The identification was based on the ITS sequence. It remains unclear of this isolate represents a contaminant. >Contig_1 CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAGT CGGCTTTCCTTGTATTATCCAGGCCTATGTCTTACACA TACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTA GTGCCTATAAACTATATACAACTTTCAGCAACGGATCTC TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATG CCTGTTTGAGTGTCATTAAATTCTCAACCTTATTAGCTT TTGCTGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCT TTCATTAGTCTGCTCCCCTTAAATGTATTAGCCGGTGC CCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACG CCGTGGACGTCTGCTATAATGGGTTTGCGCTGCTTCTAA CCGTCTCTCGGGACAACACAAATGACAA Source: CBS IDENTIFICATION SERVICES Reference: det 07-138 Location: UTRECHT, THE NETHERLANDS, Date: SEPTEMBER 11th, 2007 Comment by P.D.F. VanEeden - September 16, 2007 at 8:08 am For a copy of an uninterrupted ITC sequence as published above, please visit: silentsuperbug-reference.blogspot.com/Comment by P.D.F. VanEeden - September 16, 2007 at 8:22 am microdot I had to fix your post Microdot. Continuous letters without spacing resizes the entire thread.
|
|
|
Post by Admin on Oct 9, 2007 21:33:45 GMT -5
It seems like everyone who has ever tried to help us has been attacked, ridiculed, accused of "hiding information" or worse. This is madness, and does NOT ever help our situation. I don't know what they did to deserve it, when all they have ever tried to do is help us.
|
|
|
Post by Administration on Oct 9, 2007 21:49:04 GMT -5
That's not true Anne, we only delete posts that are out of line or hurtful toward others, per the Rules that every single message board has. And as for asking for your opinions, I can't count the times we have begged you all to contact us with any questions, comments, or suggestions you might have. Instead, everyone prefers to act out on the board and we just won't allow it. There are plenty other boards around that do, but we were trying to keep this one clean and free of that type of behavior. I can see it's not a popular idea but I'd rather not have a forum than let it turn into the others I've seen. That includes the one you recommend, Jane. It's just too bad everyone won't be able to see the ugliness that was once allowed there, it just might make you think twice about certain things.
I don't know what's happened to everyone but you know how we feel about certain things like gossip and misinformation, yet you continue to push and push and push. If you want to start another forum, please do it by all means. I'm not being sarcastic, I really wish there were more around so this is a good time for Prevenge to start one up. There's just no way on earth that you can please everyone, but you'll learn this and much more soon enough. Not everyone is going to get along no matter where you are, but I honestly do hope that it works out for all of you who do not like the rules here. It's a thankless job and we certainly didn't do it for our health, we did it because we care about all of you and that's not going to stop just because you start your own message board. You will always be like family to us, and more.
|
|
|
Post by lilsissy on Oct 9, 2007 21:53:28 GMT -5
I think our medical community has for so long neglected parasites in diagnosis in our community that they are now common to all . Then add to that emergent diseases and emergent technology and we have a whole brew- ha-ha of coexisting manifestations.
Which would probably indicate it is in the water folks. Lilias
|
|
|
Post by reasonable on Oct 9, 2007 21:53:39 GMT -5
Admins, From what I've seen 2 days ago, there were questions about Dr. Harvey letter, but no derogatory comments. Knowing the members of this board, I imagine that there were very few such comments. Why would not you delete just those and leave the rest of the thread intact? Removing the whole thread seems - well... whatsa word... It does not make you look good.
|
|
|
Post by prevenge on Oct 9, 2007 22:05:15 GMT -5
Admins, From what I've seen 2 days ago, there were questions about Dr. Harvey letter, but no derogatory comments. Knowing the members of this board, I imagine that there were very few such comments. Why would not you delete just those and leave the rest of the thread intact? Removing the whole thread seems - well... whatsa word... It does not make you look good.
|
|
|
Post by lilsissy on Oct 9, 2007 22:12:46 GMT -5
In seeing what we can agree upon . I do want you to know your efforts , I believe as administrator are born out of love . I thank You for this Board . It has been a wonderful experience in a terrible disease.
I also believe that others who may not agree with your censorship do so out of love also. Oft' time love of life or sick family or the nearly extinct American Free Press.
I don't know if their will ever be a meeting of the minds or should there maybe ever be on censorship but let's focus less on fear .
Censorship is really scary to me and I imagine to all Morgellons suffers.
|
|
|
Post by microdot on Oct 9, 2007 22:34:59 GMT -5
Dear Toni,
Please do not be ascared.
microdot
|
|
|
Post by reasonable on Oct 10, 2007 0:37:59 GMT -5
It seems like everyone who has ever tried to help us has been attacked, ridiculed, accused of "hiding information" or worse. This is madness, and does NOT ever help our situation. I don't know what they did to deserve it, when all they have ever tried to do is help us. It is ironic that nowadays one can get more info about the current research on morgwatch than on this board. Here we are spammed with pseudo-sci inanities intermitten with occasional bickering and commiseration and are discouraged from discussing what matters to us most. It is true that many members here do not know how to express themselves civilly, but the admins are not much better if they won't allow to question a theory only because "all they have ever tried to do is help us".
|
|
|
Post by gregor on Oct 10, 2007 4:13:04 GMT -5
I really was shocked by the now-deleted Dr. Harvey thread, even though I understand the anger and frustration people feel. Why not wait for the actual publication or paper, and then start the discussion? My summary, or, how I rtemember it...: Dr. Harvey, in an email to someone, described research that will be contained in a paper he plans to submit. And people are outraged! We learned here yesterday he's keeping secrets, withholding information, doing unethical research using imaginary patients (haven't introduced themselves to us, on this board, have they now), spreading false information... To be blunt, we must look to "outsiders" like we're a bunch of babies, screaming and rattling our crib bars because Dr. H. hasn't cured us yet, and therefore he's rubbish. And re: psychiatric diagnoses: tinyurl.com/35m9m4 ..geez you guys. I've always been in awe of the administrators' wisdom. Thank you, admins. you are appreciated Angry legions, and angry lesions, shoot your best shot
|
|
|
Post by Jill on Oct 10, 2007 7:10:28 GMT -5
Gregor,
I don't think that folks are screaming and rattling the crib bars- I think they are fighting for their lives and the lives of their loved ones.
I believe that they believe- that they have been uninformed and are angry that others are "in the know" and they are kept out of the loop.
Some are upset that they were not included in the study.
Some are upset that those in the study have not passed along info.
Others are upset that the info (what little has surfaced) goes back to the days of the "Old board"- ie: Oncho, etc- IOW- old info that WAS discredited by the few "experts" on the various boards.
And that Dr Harvey, who wrote a paper on "Lyme" and retired due to his Lyme disease (now read Morgellons) did not really retire, but is a part of the ongoing research that was not common knowledge.
It's not Paranoid- it's an expected human reaction. Otherwise, we would/could be just so many Lemmings.
As to those involved (in the study), some could be in Europe- I recall that Dr Harvey had posted:
Excerpt: "The Morgellon's phenomenon is real. It is also clearly devastating, life-shortening, and infectious. I have observed the herald lesions microscopically with their central fibers in dozens of patients. Virtually all have lost both income and medical insurance, and are now a significant drain on the medical system, the federal budget and their immediate social system. …international link up with physicians in Europe and most other English speaking countries has resulted in a crescendo in awareness of the illness, and collection of large amounts of publishable data. Tragically, the roots of the illness now appear to be global…." - William T. Harvey, MD, MS, MPH San Antonio, Texas
**
Last observation- seems that Dr Harvey took a turn 180 degrees away from Lyme- that is confusing since he wrote a paper on the subject, but maybe not?
If we look at what happens to doctors that support Lyme treatment, that may not be so odd.
Case in point- Jemsek Clinic.
Google: keywords- Doctor/lost license/Lyme disease/Treatment
The list is long.
|
|
|
Post by toni on Oct 10, 2007 9:42:22 GMT -5
Microdot,
What do you mean?
|
|
|
Post by ppy18 on Oct 10, 2007 12:55:40 GMT -5
give me a break gregor. of course people are going to be teed when our disease is being covered up with illusions of delusions. i do not need psychotropics to treat my illness,maybe you do. to make an issue out of the delusional aspect of this disease is controversial at best. it serves no purpose except to further muddy the waters. Dr Harvey seems to want to highlight a mental aspect of morgellons disease in his correspondence. even if it was not meant for the general public at this time his research is paving the way for doctors to prescribe orap instead of treating our symptoms. think not? you better reread his e mail. delusional aspect can be treated independently with success. well treat your 25 patients Dr Harvey. i hope since you suffer from morgellons as well that you will be first in line to get your delusional medication. i prefer being treated for my numerous infections, caused by this nightmare, first. maybe then we can move on to your delusions. c-ya in the ward buddy
|
|
|
Post by lydski on Oct 10, 2007 13:03:25 GMT -5
totally agree ppy, very well said (brief & to the point)
|
|
|
Post by Patti on Oct 10, 2007 14:00:21 GMT -5
I don't have the time right now to respond to last night's attack but I believe you misunderstood Dr. Harvey's words, Kelly. I do understand how one might feel the way you do, though I wish everyone would please realize this was not the final unabridged copy of the study results and conclusions. None of us can really speak to the email we were inadvertently shown, because it was a personal response to questions that were asked of him.....questions that none of us were privy to. Anything we could say would only be assumptions on our part, and it's dangerous to form assumptions without all the facts......just as it's dangerous to form an opinion of this study before they have completed it. New findings are taking place everyday and this now infamous email was in no way an official copy of what will be released later on. He definitely said it was not DOP, but there were some delusional COMPONENTS due to brain limbic system abnormalities in many (but far from all) cases. Nobody is covering anything up, least of all with "illusions of delusions" and even moreso, least of all Dr. Harvey. There could be many reasons for these few cases he spoke about, but commenting without facts to back it up only causes more confusion for us all. I'm asking everyone right here and now to please stop speculating and discussing this subject until we know more. When the study is released, you can comment all you want but doing so now in such a heated manner as last night is just plain irresponsible. If you all could just think about the repercussions and what this is doing to us as a group, hopefully you will come to the same conclusion.
|
|
|
Post by beckybailey on Oct 10, 2007 14:22:03 GMT -5
Well, thank God for printers.....
I thought that maybe we were going to find out later that the email was leaked here with his permission, since morgellons.com apparently didn't want his research released until totally proven...or something along those lines.
|
|
|
Post by Patti on Oct 10, 2007 14:40:19 GMT -5
......... apparently............ ...or something along those lines............ My point proven already. (And btw, would you want a study of this importance to be released BEFORE it was proven to be accurate?) The world is indeed again flat. <><><><><><>
|
|